코스모진텍
  • SERVICE
  • Gene Synthesis

GeneSynthesis

  • 소개

서비스 종류

  • Gene Synthesis Service
  • gBlocks® Gene Fragment Service

Gene Synthesis Service 소개

  • Automated synthesis platforms으로 Human error를 최소화하여 신속하고 정확한 유전자 합성서비스로 업그레이드 된 고품질의 유전자 합성 서비스를 이용하세요
    • 100% accuracy guaranteed : 100% sequence 보장 (Sanger Sequencing up to 500 bp / NGS over 501 bp 결과 발송)
    • Cloning into standard vector for free : 기본벡터에 무료로 cloning 하여 제공
      (무료제공 vector : pUCIDT(Amp), pUCIDT(Kan), pIDTSmart(Amp), pIDTSmart(Kan) 중택 1 가능, Smart는 200 mer이하 합성시)
    • Up to 4ug of lyophilized plasmid : 추가비용 없이 최대 4 ug 제공 (동결건조)
    • Free codon optimization : Host 따른 무료 codon optimization!
    • Documentation
      • -   Sequence chromatogram trace file
        -   Plasmid DNA sequence
        -   Summary report

Gene Synthesis Applications

    • - Protein Expression of recombinant antibodies, fusion proteins, novel proteins, and functional peptides
    • - microRNA genes
    • - Template for in vitro transcription (IVT)
    • - Regulatory sequence cassettes
    • - Custom vectors
    • - Gene variants and SNPs
    • - Mutation studies, including mutant libraries
    • - Standards for quantitative PCR and other assays
    • - shRNA expression cassettes
    • - Synthetic repeat constructs
    • - Microarray-ready cDNA
    • - DNA vaccines and vectors

Automatic Review 조건

  • 유전자 합성 진행 시 아래의 조건의 sequence들은 자동으로 review가 들어갑니다. Review 후에 합성 가능 여부 및 소요 기간 등을 다시 알려드립니다.
    1) Secondary structure: Hairpins >10 bases and G/C-rich secondary structures
    2) Repeats and homo-polymeric runs: long repeats, >10 bases for G/C, or >30 bases for A/T
    3) Overall GC Content >65% and regional GC content <25%
    4) Restriction site duplications and Dam/Dcm Methylation sites that may interfere with digestion by restriction endonucleases

Synthesis Price

  • 25 bp ~ 400 bp
    1-2주
    401 bp ~ 1500 bp
    2-3주
    1501 bp ~ 3 kb
    3-4주
    5 kb 이상
    3주 이상
    기본 IDT Vector 이용시 180,000원 / gene 500원 / bp 500원 / bp 별도문의
    Subcloning 서비스 연계 주문 시
    - vector는 user 제공
    - Subcloning 비용별도
    156,000원 / gene 450원/bp 450원/bp 별도문의
  • * VAT 별도

Cloning vector

  • 모든 유전자는 별도표시가 없는 한 IDT의 특별 cloning vector인 pUCIDT에 공급됩니다.
    200 bp이하의 Gene은 PIDT Smart Vector에 제공됩니다.
    제한효소 사이트나 promoter를 원하는 경우 주문시 시퀀스에 포함하거나 요청할 수 있습니다.
  • Vector Name Size Selection marker Application 추가비용
    pUCIDT (Amp) (201 bp 이상) 2,752 bp Ampicillin Cloning Free
    pUCIDT (Kan) (201 bp 이상) 2,705 bp Kanamycin Cloning Free
    pIDTSmart(Amp) (200 bp 이하) 2,056 bp Ampicillin Cloning Free
    pIDTSmart (Kan) (200 bp 이하) 1,962 bp Kanamycin Cloning Free
    pIDTBlue 2,951 bp Ampicillin In vitro transcription 90,000원
    pIDTBlue (5' T3 Promoter) 2,951 bp Ampicillin In vitro transcription 135,000원
    pIDTBlue (5' T7 Promoter) 2,951 bp Ampicillin In vitro transcription 135,000원
    pBRIDT 3,170 bp Ampicillin Cloning Inquire
  • * VAT 별도

Vector 자세히 보기

TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCAAATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCATCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCAACGCGATGACGATGGATAGCGATTCATCGATGAGCTGACCCGATCGCCGCCGCCGGAGGGTTGCGTTTGAGACGGGCGACAGATATCAGTTCTGGACCAGCGAGCTGTGCTGCGACTCGTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGTCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG GCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTACCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC

Technical Note

    • * Mixed base나 modified base는 유전자 합성이 불가합니다.
    • * Host에 따른 codon optimization 무료입니다.
    • * Sequence의 난이도에 따라 합성 기간의 연장 및 추가 비용이 부과될 수도 있습니다.
      (GC content가 현저히 높거나 낮은 Sequence일 경우(>65% , < 25%), Repeat sequence가 2개 이상 존재하는 경우)
    • * Sequence 변경은 주문 후 1시간 이내에만 가능합니다. (합성이 진행된 후 취소 시에는 전체 금액의 10%를 취소 비용으로 지불해야 합니다.)

gBlocks® Gene Fragment Service 소개

    • - gBlocks® Gene Fragments 합성 가능 길이 : 125 - 3,000 bp
    • - Linear fragment의 double strand DNA
    • - Sequence : 100% 검증된 제품
    • - Amount : gBlocks® Gene Fragments product 발송 (클로닝 또는 qPCR control등의 실험에 충분한 양)
    • - 원하는 벡터에 사용자가 직접 클로닝 가능
    • - A, T, C or G residues only
    • - High fidelity gene fragment 제공. 합성시간 단축과 비용절감 효과를 동시에!!

gBlocks® Gene Fragments Libraries

    • - Available in lengths of 251–500 bp
    • - Up to 18 consecutive N or K residues
    • - Delivered dry, normalized to 200 ng
    • - 약 3-4 주 소요

Sequence 검증

    • - 모든 gBlocks® Gene Fragments는 sequence 검증된 제품이며, 직접 cloning 했을 때 90% 이상의 colony에서 정확한 sequence의 insert 확인이 가능했습니다. 복잡한 구조의 sequence의 경우 fidelity가 떨어질 수도 있으며 이럴 때에는 추가적인 clone을 더 취하여 sequencing을 해보셔야 합니다.
    • - 모든 주문은 합성 전문가에 의해서 바이오 안정성 검사를 거칩니다. 바이러스나 유해 물질을 coding하고 있을 때에는 미국 정부의 수출 허가를 받아야 합니다.

합성 가능한 수식 종류

    • - 5' Phosphorylation (추가 비용 없음)
    • - A/T/C/G DNA bases만 가능
    • - 기타 수식합성 또는 변형 base 추가 안됨

gBlocks®을 이용한 아주 간편한 cloning applications 방법들

  • gBlock 사용 방법 주문 방법
    To blunt clone into a vector 5' phosphates 수식합성 추가하여 주문
    To clone with restriction sites 5' phosphates는 없애고 제한효소 사이트를 gBlock의 양 말단에 추가하여 주문
    To clone with the isothermal method 5' phosphates는 없애고 Nature paper의 protocol를 따라 실험
    To clone with T/A cloning 5' phosphates 수식합성 추가하여 주문 (단, TOPO cloning kits from Life technologies 또는 the StrataClone kit from Agilent Technologies는 제외).
    각 제조사의 protocol 참조

Synthesis Price

  • Gene Fragments 소요기간 (weeks) Yield (ng) 소비자가 (*VAT 별도)
    125 ~ 250 bp 1~2 250 120,000원
    251 ~ 500 bp 1~2 500 120,000원
    501 ~ 750 bp 1~2 500 140,000원
    751 ~ 1,000 bp 2~3 1,000 160,000원
    1,001 ~ 1,250 bp 2~3 1,000 240,000원
    1,251 ~ 1,500 bp 2~3 1,000 280,000원
    1,501 ~ 1,750 bp 2~3 1,000 320,000원
    1,751 ~ 2,000 bp 2~3 1,000 360,000원
    2,001 ~ 2,250 bp 3~4 1,000 440,000원
    2,251 ~ 2,500 bp 3~4 1,000 490,000원
    2,501 ~ 2,750 bp 3~4 1,000 550,000원
    2,751 ~ 3,000 bp 3~4 1,000 610,000원
top
    • (주)코스모진텍
    • 대표이사 : 이영준
    • 사업자등록번호 : 209-81-25456
    • 본사 서울특별시 성동구 성수이로 10길 14 (성수동2가, 에이스 하이엔드 성수타워) 304~311호
    • 대전 대전광역시 유성구 유성대로 794(지번주소:장대동 342-1)6층 뉴토피아빌딩 601호
    • Copyright ⓒ Cosmogenetech co, Ltd. All rights reserved